Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0553
Clone ID CF0553
Vector pGT0lxr
Project sanger

Sequence tag CF0553
Sequence
GTTTTTTAAAAGGTTTTTTTTTTTTTTTTCGCGGTTCATCTGCCCTGTGGTGGGCCTGGAGATGAATGGCCGGCACAGGT
TTTGCTTCCTCCGATGCTGCGGTTGTGTGTTTTCTGAACGCGCCTTGAAGGAGATAAAAGCTGAAGTGTGTCACACG
Sequence Type mRNA
Unitrap ID UNI532

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 172272213..172272613 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027502 (2410001C21Rik) NM_025542 RIKEN cDNA 2410001C21 gene Gene [Source:MGI Symbol;Acc:MGI:1913654]

 
Come back to gene ENSMUSG00000027502


For any suggestions or comments, please send an email to unitrap@crg.es