Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13220F6
Clone ID IST13220F6
Vector VICTR74
Project tigm

Sequence tag IST13220F6HMR1
Sequence
CTATAACTCAAAGCTCAGGGGATCTGAAGTCTGGTTTCCATGCACACCTTCACTTTGTGCACATGTCCACCTCAGACACA
ATCAAAAATAGAAAACTCAAAAGAAGGAGGAGGAGTAACAGGAAGAGGAAGAGGAAAAAGGAAGGAAAAGAAGACGGGGA
AAGGAAGAGGAGGAGGAGGAAAAAGAAGCTGGGCCTGATAGATTGAATCTCTAATCCTAGCTAACACCTAGGAGGCAGAG
GCAGGCAGGACCTCTAAATTTGAGGCCTGTCTGGTTTACATGGCAGATTCCAGGCTATCCAAGGTTTCATATAGAGTCTC
TGTCTCAATAAAGGAAAAAACAAAAAACAATTTAGCCTGTTTAGTACATTCAGTGTTTTGTAACTGTTACTACTGTCTAA
TCCTGGAAGANGTTCATCCCCCAAAGGAGCCCCATCCCTTTGGAGTCTTTATTCNTTCTTTCCTCTCTCAATTCTGGCAC
NNNCTATCTGCCTTCTGTCANTGGATGGTAAACAATCTGGCCTTTTATGANTGANCTATTTANCTCCGCATGGTNCTTAC
AN
Sequence Type genomic DNA
Unitrap ID UNI10419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40085511..40086071 541
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038481 (Cdc2l6) NM_198164 cell division cycle 2-like 6 (CDK8-like) Gene [Source:MGI Symbol;Acc:MGI:1925584]

 
Come back to gene ENSMUSG00000038481


For any suggestions or comments, please send an email to unitrap@crg.es