Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13234D4
Clone ID IST13234D4
Vector VICTR74
Project tigm

Sequence tag IST13234D4BBF1
Sequence
ATCNCCACATGGACCAACAGAACCACAGTCCTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174966463..174966498 34
NO GENE  


Sequence tag IST13234D4HMR1
Sequence
GTGATNATAGCAGAGGCCCTTGTCCTTTGACCCTTCCTGAGTGTGGATTAATGGGGATGAGGGAAGCTCAGTAGCCCTAG
TAGCTTGTGGACTTGGGTACCAAAGGTTTTCCACGGAGATCTCTTGCCAGCCTTGGTGCGAGGGTTCCAGCAAATACAAA
GGAATGCAGGCAGGGAGGGGAAGTTGCAAACCCACTTCTGCANTGCCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI32668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177690729..177690939 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078862 (OTTMUSG00000016327) predicted gene, OTTMUSG00000016327 Gene [Source:MGI Symbol;Acc:MGI:3709298]


Sequence tag IST13234D4HMF1
Sequence
ATCACCACATGGACCAACAGAACCACAGTCCTTGGAAATAGCAGAACTGACTCAGATAACTCAGGAAACTTGCTCCTCCT
GGCCTGGCAAAGGAGACAATTACAATCACCATGACATGGCTTTTGGCCTTCTTCACAGTTTGCAACAGATGGCTCTGAAN
AGACTCCCATAAAGAAACCCAAGCTACCTTCNNCTANGGTTCCTGATAGAGAGGCATGGACAGANTCCCTCATTAGCCTG
GAAAACACAGCTGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177690935..177691188 244
 
EST/CDNA Est Name
  BU848230.1 - DY247235.1 - BU848492.1

 
Come back to gene BU848230.1 - DY247235.1 - BU848492.1


For any suggestions or comments, please send an email to unitrap@crg.es