Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11549C1
Clone ID IST11549C1
Vector VICTR76
Project tigm

Sequence tag IST11549C1HMR1
Sequence
CATTGGGTGCAGATGCCNCCTGGGGCACCCCTGATTATTATATGCCTCAATTAACAGCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI32669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13218171..13218232 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3472900..3472961 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23343585..23343646 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 9154609..9154670 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 66480650..66480711 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074834 (Vmn2r-ps105) vomeronasal 2, receptor, pseudogene 105 Pseudogene [Source:MGI Symbol;Acc:MGI:3040709]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 24592513..24592574 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 71119429..71119490 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 18731426..18731487 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28502222..28502283 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41500450..41500511 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 39351867..39351928 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083125 (AC124198.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128811710..128811771 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4257174..4257235 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 146369643..146369704 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8045834..8045895 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083068 (AL772371.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 24132846..24132907 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3142337..3142398 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 50847594..50847655 60
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 144022642..144022703 60
NO GENE  


Sequence tag IST11549C1BBF1
Sequence
ATGTGAGGACACAGATATCTACTTTTAACTTGGGCCNATGGGGCTCGGCACCAATCTTGGAGCTGGAGTTAGAGCAGCCC
CAATGGCCNNGTTAATANACTTANAAACTTGTTGAGAAAACACATCTACCTCATTACAAAGCTTGATCATACCATTTATA
TCTAAACTCTTGGTTTTACCTCTCAGGGCAGCCCTACNTGCTGAATTGGCGTTTTNNAGANCAAGTTGTCGATCTAACAG
ACCCTCACTTTCCTCAGGTCCCAAAATTTTCTCAGCTGCTTCCTGCAATCTGGCAACGAACTGCGCATAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI8202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28502281..28502594 296
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040640 (Erc2) NM_177814 ELKS/RAB6-interacting/CAST family member 2 Gene [Source:MGI Symbol;Acc:MGI:1098749]


Sequence tag IST11549C1HMF1
Sequence
ATGTGAGGACACAGATATCTACTTTTAACTTGGGCCNATGGGGCTCGGCACCAATCTTGGAGCTGGAGTTAGAGCAGCCC
CAATGGA
Sequence Type genomic DNA
Unitrap ID UNI8202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28502281..28502366 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040640 (Erc2) NM_177814 ELKS/RAB6-interacting/CAST family member 2 Gene [Source:MGI Symbol;Acc:MGI:1098749]

 
Come back to gene ENSMUSG00000040640


For any suggestions or comments, please send an email to unitrap@crg.es