Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14886C7
Clone ID IST14886C7
Vector VICTR76
Project tigm

Sequence tag IST14886C7HMR1
Sequence
CCCAGGCCGTGTGAGCCTTCAGACCNNAGCTCCCGGGCTTGTGTTTCTTCCAGGACTGGTGCCTCGGTTCCCCAAAGTTA
AATTGTTTTCAAGCGGAGGTTGTTAGGATCTTTGTACAAAGGCAACAGGGAGCTAGAGGGGTCAGGCCACGGAGTGTGGT
GGNTTTGNCTCT
Sequence Type genomic DNA
Unitrap ID UNI14594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117166750..117166920 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14886C7HMF2
Sequence
GGGACAGGGGCTGAAAGCAGCAGCCTTCGAGCAAAGTCCTAGGACCCGGAGGCCCTACACCGCCCCGCCCCGCGGGTCAC
CGGGGCGCGGTGGCTGCGAGCCCCTCGGCCGTCAGCCGCCGACTCCTCCACCCCGCTCCGCTGCCCCCGCGGTTCCCGTA
CTGCGGCAGTGGGGTGCAGCAGGTTGAGGCTCTACGGCTCCCTCAGTCGCTGCCCGGGAGCAACACCCCGANAACAGGTG
TGCCCCCGCTNNNTNNGTGCCGGGACCCANTGCAGCGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117166919..117167197 265
 
EST/CDNA Est Name
  BY127228.1 - BQ964262.1

 
Come back to gene BY127228.1 - BQ964262.1


For any suggestions or comments, please send an email to unitrap@crg.es