Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P017E09
Clone ID P017E09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P017E09
Sequence
GGGGGGGTCGCCGCGGTCAGAACCGAAAACCCCCCTCAGCCTCCTTAAGTGGGTTTGGTGTCTCTTCAAAAGGGTGAGGT
GGCTTTGACCCCGGGTGGCCCGGCCAGCGCGTCCGAGGAGGTGGCTGGACAGCTGGAGAATGAACGGAGAAGCGGACTGT
CCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAG
Sequence Type mRNA
Unitrap ID UNI11962

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102177663..102177828 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es