Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G066C04
Clone ID G066C04
Vector U3CEO
Project ggtc

Sequence tag G066C04
Sequence
GGTTTTGGGCTGCAGTCTGGGTCTGAAGGCGGCCGGAGCGGCTGTCTCAATTACGATGAGGCTCCTGCTGCTTCTGCTGG
TGGCGGCGTCGGCGGTGGTCCGCAGCGAGGCCTCTGCCAACCTGGGCGGCGTGCCCAGCATATGTATCAACANTACAGGG
GTCTCACCCAGCNNGGATCT
Sequence Type mRNA
Unitrap ID UNI7301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58380604..58380743 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075700 (2810407C02Rik) NM_001040396 RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

 
Come back to gene ENSMUSG00000075700


For any suggestions or comments, please send an email to unitrap@crg.es