Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14799H3
Clone ID IST14799H3
Vector VICTR76
Project tigm

Sequence tag IST14799H3BBF1
Sequence
TCTGGAAAAGAGGCACCAGCTACTCAAGGCCGGATCAACAGAAGTGGGCAGTAAAACAGTCACATGGTAAACTGCACGTG
CCAGAATAAGGCTGGGCTCTCAGATCTTCA
Sequence Type genomic DNA
Unitrap ID UNI15271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20612799..20612905 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST14799H3HMF1
Sequence
CCTGCAGTGCCCAGGAGGCAAAAGTGGTCTACACGGCTAGACACGACTAACTCATGAGCAGGGGAGGAAAAAGAGACAGC
CCTTTTCCTCTTGCTCATATGGCCGAGACAGTCCACAGACGTGATGTCATGAGACAACCTTAGGGTGCCTAGGAGCTTGG
ATGTGAAGGACCCTGGAGAACATCACCTTGAGGGTCTGGCAACCTAACACCGAGCCAAGGATCTCCCCCGAGGACCTGGC
ACACCAGAGCCCAGTTCTGGGCGGCTGGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120114857..120115128 272
 
EST/CDNA Est Name
  BY784981.1


Sequence tag IST14799H3HMR1
Sequence
TTCTGAGGCCGGAAGGAGACATCGCAAGCATCTTAGAGTGCAGTCCTTTGGTCTTGAATTTCTCACTTCTCTGGGACTGT
ATCCTTTTTCCGAACTTCCATATTGATTTCACAATTCTTCTGGGAGTAGCTCTCTACTTCTCCCAAGGTCATCTATCCCT
GAGTGCCCACTTTCTCACTTCTCTGCCCTCTACCGAATTCTCTCTGCTTATCCAATTATCCTCANGTATGAAAGAGGAAT
AAAAATAAATAATTTTAANAANACNTGAAAAAGTGTGTGGCTGGCTATANGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122614943..122615234 282
 
EST/CDNA Est Name
  BQ416455.1

 
Come back to gene BQ416455.1


For any suggestions or comments, please send an email to unitrap@crg.es