Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12432G4
Clone ID IST12432G4
Vector VICTR76
Project tigm

Sequence tag IST12432G4HMF1
Sequence
GTCCTGAGGTCCGTAACTCAGTAATGGCATGCAGGCTGAACACTCTGAGTGTAGTACACTAGACCTTGGCTGAAAGTGGG
AAC
Sequence Type genomic DNA
Unitrap ID UNI32681

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66395032..66395113 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054598 (9130230L23Rik) RIKEN cDNA 9130230L23 gene Gene [Source:MGI Symbol;Acc:MGI:3041166]

 
Come back to gene ENSMUSG00000054598


For any suggestions or comments, please send an email to unitrap@crg.es