Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P004E03
Clone ID P004E03
Vector FlipROSAbetageo
Project ggtc

Sequence tag P004E03
Sequence
GCCGCCGGGACCGCTTGGAGAACAGGATATGTATTCCTCTGAGAAACCCTGGACAGCAGATCTTGGTTTAATACTGGATT
GGAACAACACCCACAGAGGTTTGCAGTCATGA
Sequence Type mRNA
Unitrap ID UNI11964

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6243981..6257505 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039046 (Usp6nl) NM_181399 USP6 N-terminal like Gene [Source:MGI (curated);Acc:Usp6nl-001]

 
Come back to gene ENSMUSG00000039046


For any suggestions or comments, please send an email to unitrap@crg.es