Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14162E3
Clone ID IST14162E3
Vector VICTR74
Project tigm

Sequence tag IST14162E3HMR1
Sequence
NCCNTCCTGATGGTCTAATACCTACCTAACTTCTCAGCTCCAAATACCTAACTTAGGCCTTAGATTTCAGCATATGAACT
GGGGAAGGTACATAGTCATTTATCACGTAACAGGATTGCTGCAGACTGGACTCAGTCGCCCCTGTGGGCAAGGAATCGGC
GGGGTGACAGACACGAACACAAGGGAGTGTTGATCTGAATGTAATTTCTCAAAGCCAGCATCANACTTATATTATAGAAG
AAAACAAGGAAGTTAGGTGATTCATTAAGGTCATCCAAGGTACATTGAGGTTACCCGATTCAAATCGACTCTTTACCCAA
AACAGAGAAATGCATACACAAAAGCTGACAGGAACCAGGCANTGTTTACAACTGGGATTAAAAAAAATCAGTGTTTACNN
CTNNAATCAAAAGCAGTGTGCCCTTGCNNTTGTTAATTCACCTTCTCCCTANNCCATTGTAAATTCCTGTGTATGGGAGT
GACTCANCTGTTATTCTNANTATTTACTCNAGTTCTTTCTNNNACNNCACCCTTCCTTCTTCCTANGCNATTGN
Sequence Type genomic DNA
Unitrap ID UNI8225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107716110..107716661 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]


Sequence tag IST14162E3HMF1
Sequence
GATTCTCCAAGCATGGTCTAAATGTGCCTGAAGAGGACACCAGAGAGCCACCTTATTCTTTCTGTCAAATAAGGATACAA
TAAAAAGTCTGCAATCAGCAATGGTCCTTCCCAGTATCTAACTACGCTGGTACCCTGAGTTCAAGGCCAGCCTGGTCCAT
GTAATGAGACCACATCTCAGAGTAAAAAAGCAAGACCAGCAAGATGTCTCAGGATCTACCACCAAGCCTGATGTGATCAC
CTGCATTCAAATTCCAGGACCAACATAGTTCANANAATTATCTCCCACAAAGTTGTCCCCGTGTATGCTGTGGTAACACA
CACCACACCAAACAAATAAATAAATGTGGATTTTAAGTGTTAAAGGTTAAAGAGATAGTGTCTTGGAAATAACTATAATA
AACAGTTTACCAAAGAATGACAGCAACCTCTCAACACAAGTCCTCGACACCCATAAAGGTGTTGCTTCCTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107716661..107717133 469
 
EST/CDNA Est Name
  BI735799.1 - CN533915.1 - BU513474.1 - BG296494.1 - CF735295.1 - CF163571.1 - BB642449.1 - BB635072.1 - BY731642.1 - CN536796.1 - BY261489.1 - CF734579.1 - CN673694.1 - CN460014.1 - BB840582.1 - BE305882.1 - CJ175454.1 - BY029288.1 - BY125091.1 - BY028492

 
Come back to gene BI735799.1 - CN533915.1 - BU513474.1 - BG296494.1 - CF735295.1 - CF163571.1 - BB642449.1 - BB635072.1 - BY731642.1 - CN536796.1 - BY261489.1 - CF734579.1 - CN673694.1 - CN460014.1 - BB840582.1 - BE305882.1 - CJ175454.1 - BY029288.1 - BY125091.1 - BY028492


For any suggestions or comments, please send an email to unitrap@crg.es