Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12499D10
Clone ID IST12499D10
Vector VICTR76
Project tigm

Sequence tag IST12499D10BBF1
Sequence
ATAGACCTACATAAGCAAGTATGCAAGCCAAGTAAAAAACAAACTAGTCAGGAGGTGGTGGTGCACGCCTTTAACCCCAG
CCCTCAGGAGGCAGGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 40078974..40079075 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038481 (Cdc2l6) NM_198164 cell division cycle 2-like 6 (CDK8-like) Gene [Source:MGI Symbol;Acc:MGI:1925584]


Sequence tag IST12499D10HMF1
Sequence
CACTGTTTATATCTTTTCAAGTTTTCCTTTCAATTTCGCAAAGAATATCTCCACAGTGTAGGTGTGAAAAGACAGTTACA
GCTATACTTACCTAGAAATTAGAAAACACAATTAATGTGGCAAATTCAAAGTACTTTGTAAATGCCCTATACTGGCTAGT
TTTGTGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 65741033..65741203 171
NO GENE  

 
Come back to gene ENSMUSG00000038481


For any suggestions or comments, please send an email to unitrap@crg.es