Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13321F7
Clone ID IST13321F7
Vector VICTR74
Project tigm

Sequence tag IST13321F7HMF1
Sequence
AACCTANNCTGTACTTANCAAGGTACCTTTCAGACCNCATGGACCACAGCAGCCATCGTTCAAAGCCTTGGGTTCAAGTG
TCCACCTCAGGGTCAGGAGATCCTCGTGAGCTACCTGCCACTTTGCTTCCCTGGAATACAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57022170..57022314 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST13321F7BBF1
Sequence
CATACAGCTGANACTGGTCTTGAACTCCTGATCCTCCTGCTTACACCCCTCGAGTACTGGGGTGACAGGGGTGCCCCACC
ACAACCAAGTATGAAACGCACTTTATGCAAGAAGGTGCCTTCCATGATGCGTGGCTTGTANCAACTGTANCACAGCGTTA
ACCTTCGCTGGCCTCAACCCCATCCTTCCTCCATTCCTTATCACAATCTCAACCTCAATCAAGTAGAANGAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168672073..168672304 224
NO GENE  

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es