Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P006B04
Clone ID P006B04
Vector FlipROSAbetageo
Project ggtc

Sequence tag P006B04
Sequence
AACCTCCTCCCGGGATCGAGCGCAGCGGCACCCCCAGGCCAGGGGCACCACTGGTGGGGCAGAAG
Sequence Type mRNA
Unitrap ID UNI4031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112279926..112279990 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es