Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11596F3
Clone ID IST11596F3
Vector VICTR76
Project tigm

Sequence tag IST11596F3HMR1
Sequence
TAAAGACACNAACAGGTCAGGCTGGGAAAAACACACAACTTTAACTGGAAGGGAAAGACTTCCAAAGAGGGGGCAAGGCG
GTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI32635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 106535056..106535141 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016386 (Mpped2) metallophosphoesterase domain containing 2 Gene [Source:MGI (curated);Acc:Mpped2-001]

 
Come back to gene ENSMUSG00000016386


For any suggestions or comments, please send an email to unitrap@crg.es