Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12416G7
Clone ID IST12416G7
Vector VICTR76
Project tigm

Sequence tag IST12416G7BBF1
Sequence
NGAGGAGCTAGAGAAAGTATCCAAGGAGCTAAAGAGATCTGTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6577886..6577927 42
NO GENE  


Sequence tag IST12416G7HMF1
Sequence
GGAGGAGCTAGAGAAAGTATCCAAGGAGCTAAAGAGATCTGCAACCCTGTAGGTGCAACAACACTATGAACTAACCAGTA
CCCCAGAGCTCTTGTCTCTAGCTGCATATGCATCAAAAGATGGCCTAGTCGGCCATCACTGGAAAGAGAGGCCCATTGGA
CACGCAAACTTTATATGCTCCAGTACAGGGGAATGCCAGGGCCAAAAAATGGGAATGGGTGGGTAGGGAAGTGGGGGGGN
GGGTNTGGNNNNCN
Sequence Type genomic DNA
Unitrap ID UNI26846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79238154..79238401 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es