Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10001D4
Clone ID IST10001D4
Vector VICTR76
Project tigm

Sequence tag IST10001D4BBF1
Sequence
GCCCCTAACCTTGTGGTTTTGTTATATTATAGCAACTTGACTCTGGTCGATATCAGACATCAATTTCTTGTTGTATTTCT
TAACCCCATTTTGCAGATGCATTTGACAAAGAATACAAGATGGCTTATGATCGTCTCACGCCGAGTCAAGTCAAGAGTAC
ACATAACTGTGACAGGCCACCAAGTACTGGAGTGATGGAATGCCGAAAAACCTTCGGAGAACCTTATCTTTAAGACGTGT
GTGTATATGTATACATTCAATATATATTGTATAGTCAGTGTACAGAGTAACACTTTTAGACTCTAAACTCCACTTTTTGA
GAATGCATTTGTAAATGGATTAGAAAGTTCAGGTGACTTTGTACAGAATGCTTTTGTGGGACAACAGTGACAGACAGGGA
GAGAGCCACTTACTTACCGTTTGTTTCTTCTTTATCAGCCCTGTAAAGTAATTACATACTCTATGATGAGGAAGTCTCTT
TTTAAAAATGGGGTAGCCACAAAATTAGACTGTCTTATGGTTTTCTCA
Sequence Type genomic DNA
Unitrap ID UNI32690

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64764670..64765194 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035492 (Dennd4a) DENN/MADD domain containing 4A Gene [Source:MGI Symbol;Acc:MGI:2142979]

 
Come back to gene ENSMUSG00000035492


For any suggestions or comments, please send an email to unitrap@crg.es