Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14496H7
Clone ID IST14496H7
Vector VICTR74
Project tigm

Sequence tag IST14496H7HMR1
Sequence
NAGGAAAGGGAGGAGGGAAGGGTTTGAAAACCAGCAATTTANAGTTTTGACTCTTCCNAATTGGTGAAGATCTTGGCAAA
TAAATGCTGGCTTTCAGACTGCATCGATCACCAGCTACCTTGGTCCATT
Sequence Type genomic DNA
Unitrap ID UNI11663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44392017..44392144 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


Sequence tag IST14496H7HMF1
Sequence
CTCATAACGAGAAAAAAGACAAATCCCAGCCATTTCATGAAACAGGACTTACCTAATGCCCACAGCGATGCGATGCGCTC
TACCTATTTCCTCCTTGGTTTCCTTTCTGAAATCCCAAGAAGAAACTGCCACTCGTACCCAGAGCCACAGTGGAAATCTA
GGCGGCTAGGAGTTCAGCTCCTTGGACCCCTCCCTTTTTAGATGGACGAACTCTGTTCCGGCCACACTTACGGAGTAACT
AACTCCGAGCTGGGTAGGCTGGAATGCCCAATGAGAAGCGCTCAAGGTGGGTGTGGGCGGGGATGTGGGGCGNNNCCTGG
CCCTTCAGGTGACCCACCCAGANCTGTCCCCTTGTCTTGGGTCGGCGTGGAAGGGTGGGGCAAAGACTCTTGCTCAGTTA
TGCAAATGCCTCTTCANANCCCGATCGCCTGGCCCTTGANACTCAGTCNCATCTCAGTACCTCTGNTACAGACTTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44392143..44392619 448
 
EST/CDNA Est Name
  BC064785.1

 
Come back to gene BC064785.1


For any suggestions or comments, please send an email to unitrap@crg.es