Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15051C10
Clone ID IST15051C10
Vector VICTR80
Project tigm

Sequence tag IST15051C10HMF1
Sequence
TGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTTCTATCTCCAGTGTTGCCTCACTTTGAGTTTTCTTT
ATTGTTTCTACTTCCCTTTTTAGGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTCCTCTTTTTC
TGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTA
TTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGG
TTTTCGGGTGTGTTGGGGTGCCCTGGACTGGGCNAAGTGGGAGTGCTGGGTTCTGATGATGGNGAGTGGTCTTGGTTCCN
GNTANTNGGATTCCNACNTTTANCTTTCNCCNTCTGGTAATCTCTGGAN
Sequence Type genomic DNA
Unitrap ID UNI29371 UNI32698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166420: 79378..79825 426
 
EST/CDNA Est Name
  CA585602.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35309765..35310212 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 41985001..41985448 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21951888..21952335 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 71399543..71399990 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39923458..39923905 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19156395..19156842 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021314 (Amph) NM_175007 amphiphysin Gene [Source:MGI Symbol;Acc:MGI:103574]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 48535001..48535448 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 88936412..88936859 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16341396..16341843 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 92271207..92271654 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 30525619..30526066 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 95931428..95931875 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 23946706..23947153 426
 
EST/CDNA Est Name
  BG081860.2 - BQ560108.1 - CA557250.1 - CA556342.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 11962549..11962996 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39299939..39300386 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 48124277..48124724 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9172191..9172638 426
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 48913804..48914251 426
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036792 (Mbd5) NM_029924 methyl CpG binding protein 2 Gene [Source:MGI (curated);Acc:Mbd5-005]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84375187..84375634 426
 
EST/CDNA Est Name
  AA030676.1 - BQ550969.1 - CB236167.1


Sequence tag IST15051C10HMR1
Sequence
NNNGTNAAATATNANGGCCNNNNNGGAATGTGAAGGCCTACTTCANATTATATAANGCCTANGTAACCTCTTACCTGGCT
AGCCTGCCATTTTGTGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15051C10BBF2
Sequence
TGCTGATGCTCAAATCTATGGTTCCAGATTTCTTTCCTAGGGTTTCTATCTCCAGTGTTGCCTCACTTTGAGTTTTCTTT
ATTGTTTCTACTTCCCTTTTTAGGTCTAGTATGGTTTTGTTCATTTCCATCACCTGTTTGTATGTTTTTTCCTCTTTTTC
TGTAAGGACTTCTACCTGTTTGATTGTGTTTTCCTGTTTTTCTTTAAGGACTTGTAACTCTTTAGCAGTGTTCTCCTGTA
TTTCTTTAAGTGATTTATTAAAGTCCTTCTTGATGTCCTCTACCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGG
TTTTCGGGTGTGTTGGGGTGCCCTGGACTGGGCNAAGTGGGAGTGCTGGGTTCTGATGATGGTGAGTGGTCTTGGTTCCT
GTTANTNNATTCCTACGTTTANCTTTCGCNNTCTGGTAATCTCTGGAGTTANTANTTATAGTTGACTCTGTTTNNNNATT
GTTCNTCNGGTNNTTCTGNTNCCGTCTNTCANNNNANCNGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene AA030676.1 - BQ550969.1 - CB236167.1


For any suggestions or comments, please send an email to unitrap@crg.es