Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14666H2
Clone ID IST14666H2
Vector VICTR74
Project tigm

Sequence tag IST14666H2HMF1
Sequence
CATGCAACTCTTCCTGGGGTCTCTGCTACTGTATCATTTGGAATCTCGAACAGCATGTAGATNNNCATCAAGCCCAATGT
GGCCTTATTTTATTATTGAAATTTTATTTATTTTTATTTTATGTATATGAGTGTTTGCCTGAATGTTTTTTTGTTTTTTT
GTTTGTTTGTTTTGGTTTTCCNAGACAGGGTTTCTCTGTATAGTCCTGGCTGTCCTGGAACTCACTCTGTANACNAGGCT
GGCCTCAAACTCAGAAATCCACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCNTGCGCCACCNCNCCCGGCTTGTT
TGCCTGAATGTATGTATATNAATTGTATATATCCCANTGTCTACNGAGATCANAN
Sequence Type genomic DNA
Unitrap ID UNI17447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148195415..148195786 348
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST14666H2HMR1
Sequence
AGAGGAAGCCTAGTGTGGGTGTGATTGTGAGAGTGTGTGGATGGTATATGCAAATGAGTGTGATTTATGGGGCCTACAGC
TAGAGGAACAAGCATCTGTGAGTGGCTTGCCACGTGTGCTAAGAGGAGCCGCACATGGGTCCCTTGTANGATTAGCAAGA
ACCCTTAACCACTGAGTCAGTTCTCCANCACGTTATCAAAAATTAATTATTTANCTTTTGGTATGTTTTTTGANACAGAG
TTTCTCTGTACAGCCTTGACTGTCCTGGAACTCACTCTGTAAACCANACTGGCCTCGAACTCNNNNNATCTACCTGCCTC
TGCCTCTGCCTCTGCCTNCNGAGTGCTGGGGTTAAAGGTGTGCNGCACTGTGGTTTTTGTTTN
Sequence Type genomic DNA
Unitrap ID UNI11931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137746838..137747219 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037364 (Ars2) NM_031405 arsenate resistance protein 2 Gene [Source:MGI Symbol;Acc:MGI:1933527]

 
Come back to gene ENSMUSG00000037364


For any suggestions or comments, please send an email to unitrap@crg.es