Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11721G10
Clone ID IST11721G10
Vector VICTR76
Project tigm

Sequence tag IST11721G10HMF1
Sequence
NTGGGGAGGGTTACCCCTAGTCTAATTCTCTAACGCTGGTCTGACTACTACCTCAGCTGTACTCCCCAAATACTTGCTGT
TGGGAATTTTCTGGGATATGTCTGCTTATGGGGTTCTGGGGAGGCATTTCACTCTGGCCCGTGTTGCTGGCCCATCATGA
CTAATANAGACCTCCGTTCTGTCTGCCTTCTCTCCTCCCTCCCTCATGGTGCCTACCANACACTTCCAGCCCGGTAACTC
GAACTCCACCTCCCTCTATTGTCCCCCAGTANTTGGCTGTTA
Sequence Type genomic DNA
Unitrap ID UNI32699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165626213..165626492 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es