Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11519H1
Clone ID IST11519H1
Vector VICTR76
Project tigm

Sequence tag IST11519H1BBF1
Sequence
TAGGTCATTGCTTCCTAGTTCTTGACAGTGTAAATGTATCTACCCTTTAAAAAACTAAGCCTATTTGATTTGGTTTATAT
TATGGAAGAGACTATGTAGACAAGTGTGGCCTCAAATTCANGAATAAGAATTTGCCTCCACACTTCTGAAATTGATAGCA
CATATTATCATGCTTGGCAATATCATTTTGAAAATGATTGTAAGGCACTGATTCTAAACNCCTGAAATGACTTTAANAGT
TATTGTATTGTCCCAANTCTNCANTGCTCTCTTTAAATGTNATTCTCTCTCTCTCTCTCTCACTCTNNNTCN
Sequence Type genomic DNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176863877..176864182 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]


Sequence tag IST11519H1HMF1
Sequence
TAGGTCATTGCTTCCTAGTTCTTGACAGTGTAAATGTATCTACCCTTTAAAAAACTAAGCCTATTTGATTTGGTTTATAT
TATGGAAGAGACTATGTAGACAAGTGTGGCCTCAAATTCAGGAATAAGAATTTGCCTCCACACTTCTGAAATTGATAGCA
CATATTATCATGCTTGGCAATATCATTTTGAAAATGATTGTAAGGCACTGATTCTAAACACCTGAAATGACTTTAAGAGT
TATTGTATTGTCCCAATTCTTCATTGCTCTCTTTAAATGTNATTCTCTCTCTCTCTCTCNCACTCTCTCTCTCTCTCTCT
NNNTCTNTN
Sequence Type genomic DNA
Unitrap ID UNI4931

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176863877..176864196 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078872 (OTTMUSG00000016569) predicted gene, OTTMUSG00000016569 Gene [Source:MGI Symbol;Acc:MGI:3650075]

 
Come back to gene ENSMUSG00000078872


For any suggestions or comments, please send an email to unitrap@crg.es