Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14209B12
Clone ID IST14209B12
Vector VICTR74
Project tigm

Sequence tag IST14209B12BBF1
Sequence
GAAGCATACATTGCTTTGACTCACAACAACCTGTAGAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108501147..108501190 44
NO GENE  


Sequence tag IST14209B12HMR1
Sequence
TTCTAACTGATAAACCNTCTCTCTAGCCTCCTTTGCCTATCTTTTCCTTTATTTTTTATTTTATTTTACTTTGTTTTTAT
TTTTTGAGGCAGGGTCTTTANATGAGGTTACCTTTAAACACAGATCCTCCTGTGTCCTTCTTGAGTACTGGGATTAAAGG
CATACACCACTGTGCC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108501188..108501363 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]


Sequence tag IST14209B12HMF1
Sequence
GAAGCATACATTGCTTTGACTCACAACAACCTGTAGAAGATCTGACACCTTCAGACCTCTTTTGGGCACTGCATTTACAT
TCATATACACACAGGCACATAATCAAAATTAAAGTATTTTTAAATTTTATGTTTCAAGCCGGGCAGTGGTGCACACCTTT
AATCCCAGCACTTGGGAGGCAGAGGCAGGAGGATTTCTGAGTACGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACA
GCCAGGCCTACACACAGAAACCCTGTCTCCTTTAAAAAAAAAAAAAAAAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108500902..108501190 289
NO GENE  

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es