Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P012C04
Clone ID P012C04
Vector FlipROSAbetageo
Project ggtc

Sequence tag P012C04
Sequence
CACTACCACTACCTTTAAGGGTGTGGACCCTAACAGCAGGAACAGCTCCCG
Sequence Type mRNA
Unitrap ID UNI4261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 115375534..115375584 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020737 (Hn1) NM_008258 hematological and neurological expressed sequence 1 Gene [Source:MGI (curated);Acc:Hn1-001]

 
Come back to gene ENSMUSG00000020737


For any suggestions or comments, please send an email to unitrap@crg.es