Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10466A3
Clone ID IST10466A3
Vector VICTR76
Project tigm

Sequence tag IST10466A3HMR1
Sequence
GANAAGCCNGANGGTGAACTTGGGTTCNAATCCTGGCTCTCCCCCTGTGTGAACTTGGCAGGTTGTTANGCCCCGCCCTC
CGAGTGTTTACGTTGTGAAATGACAAGGCAGTTCCCACTCAAGGCACAAAATGACACAGATGACTAGAGAACAGGACATT
CGTCATGAAGGTGGTGGTGACCGGCCTGCGGGACACATCCTGTGGCCCTTGTTTGCATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65201203..65201425 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es