Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P011F05
Clone ID P011F05
Vector FlipROSAbetageo
Project ggtc

Sequence tag P011F05
Sequence
CCACTTCTGCGGCGCATCCGGAGGGGCGGCCGCCATTGTGCTTCGTCGCCGACTTCTCTGCCGGTAGCCCGAGAGCCGAG
CCGAGCCCAGCGAGGAAGGCGGCGGCGGTGTGGCTGCGGCGAGCGCGACACTCCCTGCAGCGGAGTGCTCGGTGGAAGAG
G
Sequence Type mRNA
Unitrap ID UNI2331

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 60047981..60048141 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026977 (March7) NM_020575 membrane-associated ring finger (C3HC4) 7 Gene [Source:MGI (curated);Acc:March7-003]

 
Come back to gene ENSMUSG00000026977


For any suggestions or comments, please send an email to unitrap@crg.es