Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15062G4
Clone ID IST15062G4
Vector VICTR80
Project tigm

Sequence tag IST15062G4BBF1
Sequence
GTCAACATCGCCGACAGCAATGGTAACACTGCCCTGCACTACTCAGTGTCACACGCCAACTTCCCTGTGGTGCGGCAGTT
GCTGGACAGCGGTAAGCCTCCAGGCAGGACCAGCCTGATGGTCCACTGGGGGAGGCATGTCTTCCCACGCTCAGAGAGAG
TTGCCGCCTTCCTGGTCGAAAGCCCCTGCTCCCTTCACAGTCTGATGGCGGGTTGGTGGACAGGGATTACAGCTTCCCAG
TCTGATGGGGGAGACACTGCTTTGCAATCTGAGGGAACTTCCACTGTTTTGATGTAATAGAGGCAATATACCTTCTAAGT
TGGATGGGGGAGAGTGTGCCCTTCACTGACAGATGAAGGAGGCTTTGCCCTGATGGAGGAAGCTCTGTCTCCTAACTGAT
AGAGGAATGCANCCAGTCTGGTGGAACTCAGTCTTCGTAGCAGTATAGTGAATTCTGACTAGACACTANGGCACTGGCAT
AGTCACTGAGCGGTACCGGTGTGATGGATATTCTCGGTGTTAGGNATGCTGNTTNNNAANCCCTTGTGTGANGNNAANGN
CCGTGGCCTGGNGN
Sequence Type genomic DNA
Unitrap ID UNI32707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21578498..21579067 543
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]


Sequence tag IST15062G4HMR1
Sequence
TGANCCNTAGTCCAGCAGCCGGGCAGACATGGCCCTGAAGGTGACTAGATGTCGCCGCACAAGCTCAGGGTGTGCGTCAC
TGCGGCAGGCCAGGCGCAGCCACTCCTGAAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21579072..21579176 105
NO GENE  

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es