Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12003F7
Clone ID IST12003F7
Vector VICTR76
Project tigm

Sequence tag IST12003F7BBF1
Sequence
TCTGAANACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18226..18275 48
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166458: 3879..3928 48
NO GENE  


Sequence tag IST12003F7HMF1
Sequence
TCTGAAGACAGCTACAGTGTACTTACATATAATAAATAN
Sequence Type genomic DNA
Unitrap ID UNI8682 UNI30969 UNI32554 UNI32711 UNI32712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18226..18263 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166458: 3879..3916 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166338: 4932..4969 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166451: 12511..12548 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166468: 48232..48269 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166402: 2087..2124 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166364: 152124..152161 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166313: 153114..153151 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166441: 236581..236618 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079831 (AC170088.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166373: 95569..95606 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 309519..309556 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166347: 40749..40786 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161875: 123709..123746 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 144700..144737 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3491974..3492011 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3329087..3329124 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5074520..5074557 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3014550..3014587 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4478506..4478543 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3635715..3635752 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033781 (Asb1) NM_080857 ankyrin repeat and SOCS box-containing 1 Gene [Source:MGI (curated);Acc:Asb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3297043..3297080 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3228019..3228056 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4512894..4512931 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 6042728..6042765 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4171370..4171407 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3553241..3553278 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3640656..3640693 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3164870..3164907 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3144736..3144773 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4557862..4557899 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9185301..9185338 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3093306..3093343 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3395067..3395104 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4748308..4748345 38
NO GENE  

 
Come back to gene ENSMUSG00000033781


For any suggestions or comments, please send an email to unitrap@crg.es