Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CF0416
Clone ID CF0416
Vector pGT0lxr
Project sanger

Sequence tag CF0416
Sequence
ATACTTGCAGGGAGTAGTTTTCCGCTGTGATAAGTGTACCTTCACCTGCTCCAGTGACGAGAGTCTCCAGCAACACATAG
AAAAGCACAATGAACTGAAACCGTACAAATGCCAGCTCTGCTACTATGAGACCAAGCACACGGAGGAACTGGACACTCAC
CTTCGGGATGAGCACAAG
Sequence Type mRNA
Unitrap ID UNI1759

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55072932..55073109 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060206 (Zfp462) NM_172867 zinc finger protein 462 Gene [Source:MGI (curated);Acc:Zfp462-001]

 
Come back to gene ENSMUSG00000060206


For any suggestions or comments, please send an email to unitrap@crg.es