Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P015A07
Clone ID P015A07
Vector FlipROSAbetageo
Project ggtc

Sequence tag P015A07
Sequence
CGGAGGGCGGACAGGGCGGGCGCGTGCAGCTCAGGTCGGGCGCCCAAGACGAGGGGCCTCTGGCAGGCACCTGAG
Sequence Type mRNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17233749..17233823 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es