Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10253D7
Clone ID IST10253D7
Vector VICTR76
Project tigm

Sequence tag IST10253D7HMF1
Sequence
AATACACGTAACTTTAAAAAAAATTCTGTGGTGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57002788..57002823 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es