Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P015H04
Clone ID P015H04
Vector FlipROSAbetageo
Project ggtc

Sequence tag P015H04
Sequence
CACTTCCGGGTCGGGGAGCGCGCGGCGACGGCGGCGGCGGCTGACCGGCCTACTTGCGGTCGTGTTCGGACAGAGGCGGG
ATCGTCTAGGAGCGTCCGGGAGGCGCGAGGTTCCCGG
Sequence Type mRNA
Unitrap ID UNI162

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148414674..148414790 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038611 (Phrf1) NP_001074587 PHD and ring finger domains 1 Gene [Source:MGI Symbol;Acc:MGI:2141847]

 
Come back to gene ENSMUSG00000038611


For any suggestions or comments, please send an email to unitrap@crg.es