Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14935C1
Clone ID IST14935C1
Vector VICTR76
Project tigm

Sequence tag IST14935C1HMR1
Sequence
CACGCAGGTGTCTCGGCTCACCGAGCACCAGCGCATCCACACAGGTGAGCGGCCCTTCGCCTGTCCCGAATGTGGN
Sequence Type genomic DNA
Unitrap ID UNI31610

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13628846..13628920 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030380 (Mzf1) NM_145819 myeloid zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:107457]


Sequence tag IST14935C1HMF1
Sequence
CGTGAAGCCGAGGCCGCACTCACCGCAGCAGTAGGGCTTCTCGCCAGTATGGGTCCTTTGGTGGCGCGTGAGCTTGAGTC
GCTGGCTGAAGCGCTGGCCGCACTCGGGGCACNCNAANGGCTTCNNANCCGTATGCNNACNCANGTGCTGCNTGANCGTG
GN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14935C1BBF1
Sequence
CGTGAAGCCGAGGCCGCACTCACCGCAGCAGTAGGGCTTCTCGCCAGTATGGGTCCTTTGGTGGCGCGTGAGCTTGAGTC
GCTGGCTGAAGCGCTGGCCGCACTCGGGGCACGCGAAGGGCTTCTCACCCGTATGCACACGCAGGTGCTGCGTGAGCGTG
GGCCGCTGGCGGAAGGTCTTGCCACATTCGGCGCAGGCGAAGGGCCGCTCTCCAGTGTGGATGCGCTGGTGCTGGGTGAG
ATTAGAGCGCTGCCGGAAGCTTTGGCCGCACTCGGCACAGGCGAANGGCCGTTCGCCGCTGTGCACGCGCCGGTGCTGCN
NNANCACNGAACGGCGGCCNAANCGCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13628917..13629263 331
 
EST/CDNA Est Name
  BB855381.1 - CA542859.1

 
Come back to gene BB855381.1 - CA542859.1


For any suggestions or comments, please send an email to unitrap@crg.es