Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P015E07
Clone ID P015E07
Vector FlipROSAbetageo
Project ggtc

Sequence tag P015E07
Sequence
ACCCAACCAACCCCAAGCAAGCCGGGAACCCGGAAGTACTTCTCTGCAGAGGCCTGGGCGACTCTTTTGAATGGAATCGG
GCTGATTCATCGCCTGTTCTCCGAGCCAGGTCCTTGTTGAGTGTGAGGCGCTGCCCTCGCCGCCGCGTCGCCACAAGGCC
AG
Sequence Type mRNA
Unitrap ID UNI11980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61549777..61549930 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es