Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P015E12
Clone ID P015E12
Vector FlipROSAbetageo
Project ggtc

Sequence tag P015E12
Sequence
ACACCGACTCGCAGACTTTGCGCTTGGGGAGACGTGTAGAGGCCGGGTTCGGCCTTTCTTGAACTCTCACCCCAGCGCGT
GGGTTTCTCTTTCCGGGACAAGATGGCGCCGTCCACACCGCTGTTGACAG
Sequence Type mRNA
Unitrap ID UNI10888

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58329879..58330008 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027810 (Eif2a) NM_001005509 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2a-001]

 
Come back to gene ENSMUSG00000027810


For any suggestions or comments, please send an email to unitrap@crg.es