Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14532G10
Clone ID IST14532G10
Vector VICTR74
Project tigm

Sequence tag IST14532G10BBF1
Sequence
GGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCATAAATCCACCTGCC
TCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGAATTTTAAATCGGACCTAATTAAGTCAGACAGCCAAATATGGCTACTG
ACTACTCAAATATGGCAGTCCCAGAGTTGTAGAAAAGACAGAAAGTTATTAAACAAGCCAATAACTATAGGTAGTTGGGT
GGTTGTCAGAAAAGGCCTCTCTAAAGAAATCTGGATTACAGTACATGTTATTGCTATTTACTTCAGAAACTAATTAATAG
CAAAGAACCCTACTCANANTGCTACCCTGCCTTGTTCTATTTCCGCACCTACCACAGTTAAGTATTCCTTGATCGTGTTT
GTACAANTCATCTATAAAAATCTCNNAACTGANNNNNTCNTGAAACGTTCCNAATACATNAGTGCCNANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46439012..46439482 441
 
EST/CDNA Est Name
  BB610892.1 - EL608034.1 - BB648151.1 - BY304680.1 - BY306363.1 - BY306362.1 - CJ183105.1 - CJ164260.1 - CJ165190.1 - CJ166978.1 - CJ167643.1 - BY298760.1 - CJ167626.1 - CJ170327.1 - BY303835.1 - CJ161962.1 - CJ161644.1 - BY279261.1 - BY040760.1 - BY301452


Sequence tag IST14532G10HMR1
Sequence
ACCCTGTCTNAAAAAACAAAAACCAAAACAAAACAAAACAAAAATCAGTTCTTCTTTTACAGT
Sequence Type genomic DNA
Unitrap ID UNI3186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46438953..46439015 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024477 (Pggt1b) NM_172627 protein geranylgeranyltransferase type I, beta subunit Gene [Source:MGI Symbol;Acc:MGI:1917514]


Sequence tag IST14532G10HMF1
Sequence
GGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCATAAATCCACCTGCC
TCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGAATTTTAAATCGGACCTAATTAAGTCAGACAGCCAAATATGGCTACTG
ACTACTCAAATATGGCAGTCCCAGAGTTGTAGAAAAGACAGAAAGTTATTAAACAAGCCAATAACTATAGGTAGTTGGGT
GGTTGTCANAAAAGGCCTCTCTAAAGAAATCTGGATTACAGTACATGTTATTGCTATTTACTTCANAAACTAATTAATAG
CNAAGAACCCTACTCANAGTGCTACCCTGCCTTGTTCTATTTCCGCACCTACCACAGTTNAAGTATTCCNTGATCGNGTT
NGTACNAGTCATCTATAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46439012..46439431 401
 
EST/CDNA Est Name
  BY304680.1 - BY306363.1 - BY306362.1 - CJ183105.1 - CJ164260.1 - CJ165190.1 - CJ166978.1 - CJ167643.1 - BY298760.1 - CJ167626.1 - CJ170327.1 - BY303835.1 - CJ161962.1 - CJ161644.1 - BY279261.1 - BY040760.1 - BY301452.1 - BY211657.1 - BY212431.1 - BY213430

 
Come back to gene BY304680.1 - BY306363.1 - BY306362.1 - CJ183105.1 - CJ164260.1 - CJ165190.1 - CJ166978.1 - CJ167643.1 - BY298760.1 - CJ167626.1 - CJ170327.1 - BY303835.1 - CJ161962.1 - CJ161644.1 - BY279261.1 - BY040760.1 - BY301452.1 - BY211657.1 - BY212431.1 - BY213430


For any suggestions or comments, please send an email to unitrap@crg.es