Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14487H7
Clone ID IST14487H7
Vector VICTR74
Project tigm

Sequence tag IST14487H7HMR1
Sequence
TGCCTCTGCCTCCCAAGTGCTGGGATTAAAGGTGTGCT
Sequence Type genomic DNA
Unitrap ID UNI2895 UNI31810 UNI32719 UNI32720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27231369..27231406 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37554083..37554120 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28265184..28265221 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022523 (Fgf12) NM_183064 fibroblast growth factor 12 Gene [Source:MGI Symbol;Acc:MGI:109183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 26713896..26713933 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 40750552..40750589 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 41539389..41539426 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4598543..4598580 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20813640..20813677 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 18731407..18731444 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021779 (Thrb) NM_009380 thyroid hormone receptor beta Gene [Source:MGI (curated);Acc:Thrb-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 36279860..36279897 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 28382343..28382380 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031490 (Eif4ebp1) NM_007918 eukaryotic translation initiation factor 4E binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:103267]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 51405592..51405629 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13522294..13522331 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 10406968..10407005 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40593300..40593337 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 58786079..58786116 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 45255616..45255653 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 54753490..54753527 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052331 (Ankrd44) NM_001081433 ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]

 
Come back to gene ENSMUSG00000052331


For any suggestions or comments, please send an email to unitrap@crg.es