Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P015B09
Clone ID P015B09
Vector FlipROSAbetageo
Project ggtc

Sequence tag P015B09
Sequence
GGTGCGGGCGAGTTCGGCGGGTGCAGGTCCCGGCCTGCGCCTGCGGAGGGCTCAGGCAGAGGGTCGAAGCGAGCGGCGCT
CGCGACAGACTGCGCTCCGCGATGGTGGGCGTCCCTGGAGCGGCCGCCTTCCAAC
Sequence Type mRNA
Unitrap ID UNI5148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60622620..60622754 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070791 (AC140317.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154262238..154262372 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es