Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12927E1
Clone ID IST12927E1
Vector VICTR76
Project tigm

Sequence tag IST12927E1HMF1
Sequence
GTAATAAGGACCGATTCTAGAGAAACAATATAACTGTCTACGCCTCTAAATTATGATACTCTTTCTTAAGATGACTTACA
GTTAAAACGCTCTTCACAACTTTAGTGTTGA
Sequence Type genomic DNA
Unitrap ID UNI15588 UNI31033 UNI31035 UNI32369 UNI32370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44896674..44896783 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31381753..31381862 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3232281..3232390 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28106925..28107034 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8739618..8739727 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046634 (Pkd1l1) polycystic kidney disease 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2156538]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 54414002..54414111 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41653794..41653903 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 146736644..146736753 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14346396..14346505 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130151887..130151996 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 57487881..57487990 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074591 (Gm410) NM_001033349 gene model 410, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685256]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21197881..21197990 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110305831..110305940 108
NO GENE  


Sequence tag IST12927E1BBF1
Sequence
NANNNNACGCTGTCNNNNNGCCCNTGGACTTCCCANCCTCCCGAAACCACGAACTCCAAACCCTCTGTTGTTTATAAGCT
ACTCAGTTTCAGATGCTTTCTTACAGCAACGGCAAAAATGGACTAAGACGGCCTCCAGGTTCTCTTTTGTAATTTGGGAA
GAGTGGAGCCAACCTTACTGCTGACTTGAGAGAGTTAAGTGAAATTGTATGANCCGAGTGTCANCGAGGAAAGTGACTCA
CGGGGCACACTGAGCTGATATAGCCAGAGGTTACTATACTTGCAGGGCTGAAGGGCGTGGCCCAGTGGTGGAGTGCCTGC
CTGGCATACACAGAGCCCTGAGTTCAATCCCCAGCACTTAAAATACCATGCTTGCTTCAGTGTTCTTGCCTTACTCCGAN
TCTGCCCTTCACAAAATGAACGAGTTCTCGATGCCNAGCATCTGATGATCANGTCACTCTGCCCAGTGTGCGCCTCGGCC
CCATACTCTCCGGCAGCCAGTGANATTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 100401181..100401682 474
NO GENE  

 
Come back to gene ENSMUSG00000074591


For any suggestions or comments, please send an email to unitrap@crg.es