Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12417D1
Clone ID IST12417D1
Vector VICTR76
Project tigm

Sequence tag IST12417D1BBF1
Sequence
TTTCTTTTTTAATCTCCTTTTCTCCTTTTTGGGACAAGGACAAGGCAGAGGGAGAAAATTGCTCTACGCTGCAAACAGTT
GCTGGGTTTATTCAGAAAGGACTGACCAGCAACAGTTGTTCCTCTTACAGAGAAATGCAGGAACAACTGGGGCCTTCTTT
GTTCTCTGGGCAGANTCCTGTGAAGGGCATTTGGAGGTGAGCCTGGGGCTAAAGAGGGCAAGACACTCACAGTGTCAATT
GAGTCCCACCCAGGGAGTCCCCACCCCANCAAGCAGGAAAGGTTTTTANAGCTAGGCAGGGTCTGGTTAANAAGTCNGGC
CNCACCCTGGGTCCTCCGCTNANCCCTANTCAACGCAAGAANCNCTNANCNGTCNGTGTTNNTTTCANTNAATATTTATT
GGACNNACNCTGNGCTGAACAGNANTTCCGTCCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12417D1HMF1
Sequence
TTTCTTTTTTAATCTCCTTTTCTCCTTTTTGGGACAAGGACAAGGCAGAGGGAGAAAATTGCTCTACGCTGCAAACAGTT
GCTGGGTTTATTCAGAAAGGACTGACCAGCAACAGTTGTTCCTCTTACAGAGAAATGCAGGAACAACTGGGGCCTTCTTT
GTTCTCTGGGCAGAGTCCTGTGAAGGGCATTTGGAGGTGAGCCTGGGGCTAAAGAGGGCAAGACACTCACAGTGTCAATT
GAGTCCCACCCAGGGAGTCCCCACCCCAGCAAGCAGGAAAGGTTTTTAGAGCTAGGCAGGGTCTGGTTAANAAGTCNGGC
CACACCCTGGGTCCTCCGCTCAGCCCTANTCAACGCC
Sequence Type genomic DNA
Unitrap ID UNI29935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148287242..148287597 350
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es