Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12086H8
Clone ID IST12086H8
Vector VICTR76
Project tigm

Sequence tag IST12086H8BBF1
Sequence
GGAGTAAGGAGAGGTCTAAGAACTAACTATGGGCCTTAGATAATGAATGGTAGGGAATGGATGTGTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63182413..63182483 71
NO GENE  


Sequence tag IST12086H8HMF2
Sequence
CACAAAAGCATTCATATGTTGCATATGACCTGCATACATGGCAGTGGTTCTACCAAAATATGATGAAAACTTCCTATTGC
CTAGTGATGTCATAGCTTTCCTAATGTTGTAACGCATACGTGACTTATGTCTATGGTGCTACTGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI14987

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45597589..45597736 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es