Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10083G4
Clone ID IST10083G4
Vector VICTR75
Project tigm

Sequence tag IST10083G4BBR1
Sequence
CTCATGTCAGTAGCTCTGCTTTGATTACCTTAGTTTTCTAGTAAATTTTGACAACATGAAATAAGTTCTCCAACTTTTTT
TCAAATTAAGTTAAATTAGTTTTAGTAATTTGACAGCATGCCACTTCATCATATAATCAACATAAACGTTGTTGATGAGG
TTGTTTACATTCGTTCATAATAAGGCTTGAAATTTGTCTGTATTTAAATTAATTTAACTGTCATTCAGTTCAGACTAGCC
ACACCTGGGGCCACATGTGGATCATGAGCACTGCATTGTGTGGCTCAGAGTTCCCTGGGGAGTGCACGGGATGGCAGTCT
GTGACATCTGTGACAACCAATACCACAGTGCATTTGTCCCTTTAATGTTGGGGTGGCAAAAGGAAGCCATTTGTAGGTGC
CTCAATAAAGAGGCAAAGGGGGAGGATGACACAAAGGCCTGATGGGGAGGGTGACCCTTGTGCTCAGGCTTGGAGTTAGA
ATAGGGTTTTGAACAGCAGGCATGGGTGGAAGGCTGCTCTGGACAGATCGCAGCTTCATGGAGGACTCATGATTCTTGCA
GAGCCATACGCAGTTCTTCCAGCGTCACCAGGGTCTTAAA
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202651..157203249 593
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]


Sequence tag IST10083G4BBF1
Sequence
ATGAGGACAGACGGACAGACAGACAGACAGAGAGCTCCAAATAAACATTCACAGGCAGGAGAGGACAGACTTTAAACAAG
TGCTACCAAGAAACAGTGTCCACACACAAACACAAACCAACTTGTACTTCATACAAAGATTAATTCAAACCGGCCCAAGA
TCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202493..157202655 163
NO GENE  

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es