Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14604A3
Clone ID IST14604A3
Vector VICTR74
Project tigm

Sequence tag IST14604A3HMR1
Sequence
GTGTTNAGGGCTCTGAGTGCTGGTCTTCTAANACTTAAATATCTCGAGAGACAGACAGCCCAGGGTGCTGACCGAATCTG
ATACTATAGGTTTCTTAAGATGATAGACTGTTCTCACATGTCACCCAGGCTTCTACAGTGGGCCAGCCATAAACATCACT
TGCTTTGCTGTGTGACCGT
Sequence Type genomic DNA
Unitrap ID UNI32724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40178343..40178521 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]


Sequence tag IST14604A3HMF1
Sequence
AACACGAGGCAGCCTTTCTCCTTCCCGCAGGATGGTAAGATAAATCTCANTGTTCACGGGAGGGCACGCCTGTGGTTTGT
AAAGGAATATTTAATACTCTCAAATGAAGGTCTGTTGTTTTTTTTAATATCCCCTGCCAGCTAAAGAAGTGCTCCAACAG
TCTACAGCACATGCTACAGCTCTATAAAAACCGTGGCCTTTTCCTAGACCNTTTGTAAGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40178517..40178736 216
 
EST/CDNA Est Name
  CD552246.1


Sequence tag IST14604A3BBF1
Sequence
AACACGAGGCAGCCTTTCTCCTTCCCGCAGGATGGTAAGATAAATCTCAGTGTTCACGGGAGGGCACGCCTGTGGTTTGT
AAAGGAATATTTAATACTCTCAAATGAAGGTCTGTTGTTTTTTTTAATATCCCCTGCCANCTAAAGAANTGCTCCAACAG
TCTACAGCACATGCTACAGCTCTATAAAAACCGTGGCCTTTTCCTANACCATTTGTAAAAAAAAAAAAAAAAAAAAANGG
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40178517..40178757 229
 
EST/CDNA Est Name
  CD551930.1 - CD552246.1

 
Come back to gene CD551930.1 - CD552246.1


For any suggestions or comments, please send an email to unitrap@crg.es