Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11636F7
Clone ID IST11636F7
Vector VICTR76
Project tigm

Sequence tag IST11636F7HMR1
Sequence
AAAAGGCTAGAAGCTAGTCTAAACTGGAAAAATGACAAGTAAGGATGGATCTAAAACATGAATTTAATTTAGTTTTTTAG
TCAATTTAATCAGGACATGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI15587 UNI30811 UNI32041 UNI32321 UNI32725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32509683..32509785 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 38833389..38833491 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55706326..55706428 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8763223..8763325 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79509391..79509493 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047454 (Gphn) NM_172952 gephyrin Gene [Source:MGI Symbol;Acc:MGI:109602]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9872904..9873006 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7497633..7497735 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23578738..23578840 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 131623616..131623718 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056018 (1700008F21Rik) NP_083568 RIKEN cDNA 1700008F21 gene Gene [Source:MGI Symbol;Acc:MGI:1922703]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88520040..88520142 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 143433725..143433827 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88593621..88593723 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35315803..35315905 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140548..27140650 103
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11611569..11611671 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es