Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14444C9
Clone ID IST14444C9
Vector VICTR74
Project tigm

Sequence tag IST14444C9BBF1
Sequence
CTCTGGACTTTANATCATATTCATGTTTCATATGATCTCAAAATTAAAATAAGTCACCCTGAAATCAGGAGCAGCAAGAG
ACCAACTTAATCATCAAAGCAGTGAGCTATTCAGAAGGACTAACCTAGCCTANATGCTTAAACCTGTGATTCTGTGTGCC
CGTGCTAAGAGATTTCTAAAGAAGAAATAAACTTCAAATTCCTAAGTTCAGTAGAGGGAAGGAGCTGATGCTGAAATCAT
GGACACACTCAGTGAATATATATACTCAGTAGTATACATGTACACTAATGTACATATTATATATACATTTACAAGCTATG
CTGTATACAATGCAAATATGCTGCTTACAAACAGGCTTTTCTTTTTCTGTTCANCNNGANGCATTAGTTGGANANGCNNG
GGGTGTGTTNNGNNCNGNNNTNNNCNNANCNNNTAACTGTNANTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121257914..121258322 389
 
EST/CDNA Est Name
  BB861417.1


Sequence tag IST14444C9HMR1
Sequence
CTGCTNATCTTTGTATTTATAATAAATACATAGAGCATTGAAGCACATTTTAGGTATATTTAGACAGTGTTTTATTACAG
TAACCTAAACAACAAAACTGTATGTCTTCGAGTTCTAGAGTTCAAGATCAAGCAGTT
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70338322..70338458 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14444C9HMF2
Sequence
AGCAGGAGAGATGGCTCAGTGGTTAAGAGCACTGAGTACTCTTCTGGAGGTCCTGTGTTCAAATCCCAGCAACCACATGG
TGGCTCACAACCATCTGTAATAGGATCTGATGTCCTCTTCTAAGGTGTCTGAAGACAACTATACATATAATAAATAAATA
CATATAATAAATAAATCTTTTTAAAAACGAAAATAAAAANTANATAAATNCNANAACAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70338454..70338672 209
 
EST/CDNA Est Name
  CA883725.1

 
Come back to gene CA883725.1


For any suggestions or comments, please send an email to unitrap@crg.es