Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14559E6
Clone ID IST14559E6
Vector VICTR74
Project tigm

Sequence tag IST14559E6HMF1
Sequence
GGGAGAAACCTTACATTTCCCAAACCACCATCGGCGCAGGAGAGGGGAAGAAGCCGCACACCAGGCTGCGCAGCTCCTGT
TACGTAATCATTTGGACTCGACTATAAAAGCCGCGCAGAGCTCGGCAAGGGCGCGAACGTATCTACAAAATGTCCGCTGC
CGCCTTTACTCCACCACCACTCAGGCGCTGAGACCATGAACCAGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155979984..155980193 210
NO GENE  


Sequence tag IST14559E6HMR1
Sequence
CTCCCTGCANAANAGGCACACATACTCATCTCCCACCCTGCGAACTTCACTTGCAGGGTTCCAAGACTTCAATTTGGCTT
GTATTTAAGCTAGTTTAATACTATGTCCAAGCCGGGCGTTGGTGGTGCTCGCCTTTAGTCCCAGCACTTGGGAGGCAGAG
GCAGGAGGATTTCTGAGTTCTGAGGCCAGCCTGGTCTACAAAGTGAGCTCCATCCAGGACAGCCAGGGCTACACANANAA
ACCCTGTCTCAAAAAACAAAACAAAACAAAAACTATGTCCAANAAAAGTGCTTGGCTGCCGATAGGGAAGAATAACTNNT
TCTATCTTCATTTTTATTTTTAATTTAATTTTGAATATTTTGTGAGAGTTTCATTTTGTAGCCTTTGGCTAGCCTTAAAT
GCACTATTTATAACAGGCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI6910

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155980189..155980610 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es