Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13891H1
Clone ID IST13891H1
Vector VICTR74
Project tigm

Sequence tag IST13891H1HMF2
Sequence
CGATGAAGATGAGGTTCGAGTCGCGCTGGTGGTGCACTCAGGTGCTGCCCGGTTGGGCAGCCCGGACGACGAGTTCTTCC
ANAAGGTAAGGGTCAGGAGAACCGAGGAGTAGGGCGGACTANAGTGACACTTAAGTCTTCAGCCCTCTTGGTGATCCTTC
CTAGGTGCAGACAATTCGGCAGACTATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI32468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134985795..134985986 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030805 (Stx4a) NM_009294 syntaxin 4A (placental) Gene [Source:MGI (curated);Acc:Stx4a-001]


Sequence tag IST13891H1BBF1
Sequence
ACTTGCNAAATCTGTATCACTCAATAACAAGAGCTCGTTACACTTTGTGCCTTTCCATGCACTTCCTTCNGTCTGAAAGC
TTCGCTACCATCTTGCANAANAATTTACACCCGGCAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53343990..53344111 114
 
EST/CDNA Est Name
  DV063384.1

 
Come back to gene DV063384.1


For any suggestions or comments, please send an email to unitrap@crg.es