Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10256G1
Clone ID IST10256G1
Vector VICTR76
Project tigm

Sequence tag IST10256G1HMF1
Sequence
CCATTTGCCTCTGANAGGGTGCTCCAACCCCTGCAACCTCCCGCCTCCCTGAGGCATCAAGTCTCTAGAGGGTTAGGTGT
ATCCTCTCCCACAAGGCAGTCCTCTGCTACATATA
Sequence Type genomic DNA
Unitrap ID UNI32727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75559612..75559725 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020226 (Slc5a4b) NP_075708 solute carrier family 5 (neutral amino acid transporters, system A), member 4b Gene [Source:MGI (curated);Acc:Slc5a4b-001]


Sequence tag IST10256G1BBF1
Sequence
CCATTTGCCTCTGANAGGGTGCTCCAACCCCTGCAACCTCCCGCCTCCCTGAGGCATCAAGTCTCTAGAGGGTTAGGTGT
ATCCTCTCCCACAAGGCAGTCCTCTGCTACATATGTGCAGGGGTTTTAAGCCCTCTTGCTGTCCCAGGCATAAGTGCCCT
TCTGACTCCTCAGGCAAATCTGCACTGTCNTCATGATGTGTCCCGTAACGCTGGGCCTGGGTTCCCTGTTGGCTCCCACT
CCAGGGCTGGACCCAGGCTGACTTGTTCCACGCCCTTGANCCGGGTGTCTCCANANGCTCACCTAACTTTAGTGTTATCA
NAGACCTACAAGCCACTTTCTGAAATGGCTTCGTAGCCTCGTGTGGAAACTGCGTGCAAGCCTTCCACTTTCTCTGANTC
TTCACCTGCATTTGTTACTTTTNNNTGNTTGNTGGTTTTGGTTGGTTGGTTGGTTTTTTTCNANACATGGTTTCTCTGTA
TAGCCCTGGCTGTCCTGGAACTCACTNTNNNCACCANNCTGGCCTCGAACTCN
Sequence Type genomic DNA
Unitrap ID UNI32727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75559194..75559725 492
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020226 (Slc5a4b) NP_075708 solute carrier family 5 (neutral amino acid transporters, system A), member 4b Gene [Source:MGI (curated);Acc:Slc5a4b-001]

 
Come back to gene ENSMUSG00000020226


For any suggestions or comments, please send an email to unitrap@crg.es