Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13845B2
Clone ID IST13845B2
Vector VICTR74
Project tigm

Sequence tag IST13845B2BBF1
Sequence
ATAGTTGACTCTGTTTAGAGATTGTTCTTCTGGTGATTCTGTTACCGTCTATCAGCAGACCTGGGAGACAGATTCTCTCC
TCTGAGTTTCAGTGCTCANAGCACTCTCTGCTGGCAAGCTCTCTTACAGGGAAGGTGCGCANATATCTTGTATTTGGACC
TCCTCCTGGCCGAANAANAAGGCCCAAAACAGGACCTTTCTCAGACACTGTGTTGCTTTGGCAGTCCCCAGGTGGTACAG
ACTCTCACCTAANCAGACTAAATTCCTAAGTTCCTTGGANTCCCGGGACCAANATGGCNACCGCTGCTGCTGTGGCTTAT
GTCNCCTCCCCANCCGGGCGGGCACCTNAA
Sequence Type genomic DNA
Unitrap ID UNI7884 UNI15225 UNI30811 UNI31343 UNI31345 UNI31952 UNI32729 UNI32730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20829134..20829480 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 46851864..46852210 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21687358..21687704 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051341 (Zfp52) NM_144515 zinc finger protein 52 Gene [Source:MGI Symbol;Acc:MGI:99199]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 65751108..65751454 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4724825..4725171 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022181 (C6) NM_016704 complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 16482774..16483120 323
 
EST/CDNA Est Name
  BY484981.1 - AI426759.1 - CJ168023.1 - BY302409.1 - BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37887071..37887417 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036144 (Meox2) NM_008584 mesenchyme homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:103219]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27288353..27288699 323
 
EST/CDNA Est Name
  BE687203.1 - BY214152.1 - CA584372.1 - CJ223283.1 - CN671380.1 - BY484981.1 - CA886748.1 - AI426759.1 - CJ168023.1 - BY302409.1 - BX512183.1 - AW320348.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22535538..22535884 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7461972..7462318 323
 
EST/CDNA Est Name
  AI156842.1 - CB320405.1 - BY097334.1 - BU840088.1 - BI112273.1 - BY135240.1 - AW209547.1 - BY101325.1 - CA464211.1 - BU699409.1 - BY143226.1 - BE134712.1 - CA530764.1 - AL360872.1 - BY093521.1 - CJ150406.1 - BY297169.1 - AW411703.1 - BE854471.1 - BY124670
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 25661798..25662144 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59305766..59306112 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61872766..61873112 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 55559012..55559358 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987262..3987608 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12886379..12886725 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055963 (OTTMUSG00000004461) NP_776107 predicted gene, OTTMUSG00000004461 Gene [Source:MGI Symbol;Acc:MGI:3650048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5054918..5055264 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22110855..22111201 323
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209550..14209896 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616216..11616562 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]

 
Come back to gene ENSMUSG00000057715


For any suggestions or comments, please send an email to unitrap@crg.es