Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10091D1
Clone ID IST10091D1
Vector VICTR75
Project tigm

Sequence tag IST10091D1BBR1
Sequence
GTTCAGCTCCAGGGACGGCGCTTGCCCTCCTGGCCAGATCCACAGCGAGCTA
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65203944..65203995 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


Sequence tag IST10091D1BBF2
Sequence
CTACTTGTTCTCGCTCTGCCACCAACGTGGCAGGCTTTGTACAAAGAATGTGAGCTTTGTTTTGCTTAACAGACATATAT
TTTTTCTTTTGGTTTTGCTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8246398..8246497 33
NO GENE  


Sequence tag IST10091D1HMF1
Sequence
NAACTTCCTTTGTCGAGAACCCTTTCTTTACATTTCCTTANCAAACTTTCTGAGCGCTCCCTGTGACCGGTACTACAGGA
AGTACCATGCAATGGCCTGACCANAAACGCAGAGGGGCAGGCACCCTAAGCCAGGCTTGCTTANCGGGGCTGGCACCTAC
CTTGGAAGGGTGCCCACTTTTCACACCACCCAAGGACTCACCCACCTCACTCTTCCACTGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65203726..65203946 215
NO GENE  

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es